View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17839_high_1 (Length: 428)
Name: NF17839_high_1
Description: NF17839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17839_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 18 - 413
Target Start/End: Complemental strand, 12167703 - 12167308
Alignment:
| Q |
18 |
ccctttgagtttctcttctgttcttgaagacaatagaggaggaacaaacatgaatatgtttggtgatccattattctcaactttaagagatccattttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167703 |
ccctttgagtttctcttctgttcttgaagacaatagaggaggaacaaacatgaatatgtttggtgatccattattctcaactttaagagatccattttta |
12167604 |
T |
|
| Q |
118 |
caagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattgatgttgcttcttctggtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167603 |
caagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattgatgttgcttcttctggtg |
12167504 |
T |
|
| Q |
218 |
ttaatgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaacatattctcaaatatgat |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167503 |
ttagtgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaacatattctcaaatatgat |
12167404 |
T |
|
| Q |
318 |
tcagatctctcctaatccaaagttacctaattatgaatcttcttcaacaatagcagcaccttctccaagaccaattaaaccttctgctgttatttc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167403 |
tcagatctctcctaatccaaagttacctaattatgaatcttcttcaacaatagcagcaccttctccaagaccaattaaaccttctgctgttatttc |
12167308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University