View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_high_115 (Length: 209)
Name: NF1783_high_115
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_high_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 32181658 - 32181841
Alignment:
| Q |
1 |
catgttatcttccaaatactaccacaacagctgagtataatatgattgggaatagccattatcacactcttggtagtagcagcagcagtttcaatgatcc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32181658 |
catgttatcttccaaatactgccacaacagctgagtataatatgattgggaatagccattatcacactcttggtagtagcagcagcagtttcaatgatcc |
32181757 |
T |
 |
| Q |
101 |
tggaaaagctgattttggttttaagctgattgattcttcaagtcatgattttggtgttaggaaggtaaagttaatgaatggaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32181758 |
tggaaaagctgattttggttttaagctgattgattcttcaagtcatgattttggtgttaggaaggtaaagttaatgaatggaag |
32181841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University