View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_high_117 (Length: 202)
Name: NF1783_high_117
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_high_117 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 43102399 - 43102208
Alignment:
| Q |
11 |
gagatgaagaatgataggatgctagatttgctgcacgagtgcttcagtgaaggtcttatcaccaccaatcagctgactaaaggattcactcggattaagg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43102399 |
gagaagaagaatgataggatgctagatttgctgcaggagtgcttcagtgaaggtcttatcaccaccaatcagctgactaaaggattcacccggattaagg |
43102300 |
T |
|
| Q |
111 |
agggtcttgatgatctggctctggacattccaaacgccaaggaaaaatttgctttctatgtggagcatgcacagaccaaggggtggcttcta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43102299 |
agggtcttgatgatctggctctggacattccaaacgccaaggaaaaatttgctttctatgtggagcatgcaaagaccaaggggtggcttcta |
43102208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University