View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1783_high_15 (Length: 539)

Name: NF1783_high_15
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1783_high_15
NF1783_high_15
[»] chr4 (15 HSPs)
chr4 (68-539)||(51300882-51301354)
chr4 (16-69)||(43202382-43202435)
chr4 (18-77)||(54054665-54054725)
chr4 (16-69)||(53003954-53004008)
chr4 (18-70)||(50619222-50619274)
chr4 (19-73)||(16536185-16536240)
chr4 (18-68)||(16820988-16821039)
chr4 (18-72)||(29591325-29591380)
chr4 (27-70)||(34151267-34151310)
chr4 (27-68)||(11893400-11893441)
chr4 (22-67)||(43944647-43944692)
chr4 (16-61)||(54655883-54655928)
chr4 (16-75)||(4089276-4089336)
chr4 (16-67)||(12356378-12356430)
chr4 (31-66)||(16572488-16572524)
[»] chr2 (6 HSPs)
chr2 (18-77)||(20553067-20553127)
chr2 (18-69)||(34442531-34442582)
chr2 (18-75)||(31438782-31438840)
chr2 (16-67)||(22887884-22887936)
chr2 (18-67)||(30486346-30486396)
chr2 (18-66)||(4022480-4022529)
[»] chr8 (12 HSPs)
chr8 (18-68)||(27988499-27988549)
chr8 (18-68)||(28045801-28045851)
chr8 (27-72)||(42655272-42655317)
chr8 (27-73)||(2490151-2490198)
chr8 (16-74)||(13643145-13643204)
chr8 (16-74)||(13743570-13743629)
chr8 (18-61)||(28626904-28626947)
chr8 (18-67)||(34228818-34228868)
chr8 (16-59)||(7304526-7304570)
chr8 (16-67)||(16394061-16394113)
chr8 (16-67)||(20831553-20831605)
chr8 (18-73)||(30675567-30675623)
[»] chr5 (3 HSPs)
chr5 (18-77)||(34650823-34650883)
chr5 (18-70)||(35504238-35504290)
chr5 (16-69)||(35132655-35132709)
[»] chr1 (11 HSPs)
chr1 (18-73)||(5694457-5694513)
chr1 (18-70)||(29657907-29657960)
chr1 (19-70)||(18043299-18043351)
chr1 (18-68)||(29210530-29210581)
chr1 (27-69)||(14350277-14350319)
chr1 (18-71)||(15227875-15227929)
chr1 (16-69)||(47010127-47010181)
chr1 (18-70)||(51065745-51065798)
chr1 (26-62)||(17333426-17333462)
chr1 (18-77)||(38162986-38163046)
chr1 (19-70)||(42769987-42770039)
[»] chr7 (7 HSPs)
chr7 (27-70)||(19434639-19434682)
chr7 (18-68)||(42044293-42044343)
chr7 (16-66)||(11686324-11686374)
chr7 (16-70)||(12218434-12218488)
chr7 (18-67)||(24438613-24438663)
chr7 (27-73)||(34556886-34556931)
chr7 (38-86)||(24798559-24798607)
[»] chr6 (7 HSPs)
chr6 (16-70)||(392230-392285)
chr6 (16-67)||(35044023-35044074)
chr6 (16-70)||(13416957-13417011)
chr6 (18-70)||(32929505-32929558)
chr6 (16-61)||(3026015-3026061)
chr6 (18-70)||(29978368-29978420)
chr6 (18-61)||(32985199-32985243)
[»] chr3 (7 HSPs)
chr3 (19-73)||(43787008-43787063)
chr3 (18-67)||(7468546-7468595)
chr3 (18-70)||(18014808-18014861)
chr3 (19-74)||(52520818-52520874)
chr3 (18-60)||(49893467-49893510)
chr3 (18-67)||(272356-272406)
chr3 (18-71)||(39074554-39074608)


Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 15)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 68 - 539
Target Start/End: Complemental strand, 51301354 - 51300882
Alignment:
Q  68 ttatttatttcatgcttctccttttctaataaaatcttagtctcataacatgattttgtctatgttgtctcttgaggtagggaactcaatgcccacatca 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51301354 ttatttatttcatgcttctccttttctaataaaatcttagtctcataacatgattttgtctatgttgtctcttgaggtagggaactcaatgcccacatca 51301255  T
Q  168 cgtttttataatgcccattttcttggtcacatgtcttattcattctcatcattgctcttatgaacagttccannnnnnn-gggtacaatgttccattctt 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||| ||    
T  51301254 cgtttttataatgcccattttcttggtcacatgtcttattcattctcatcattgctcttatgaacagttccattttttttgggtacaatgttccattttt 51301155  T
Q  267 tcatcggaatgaataaataacaagtaaattagtactgctttttgatccatgaaagcgttaggcaccatcatattagtccttagaagaattcaaattaaga 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||    
T  51301154 tcatcggaatgaataaataacaagtaaattagtactgctttttgatccatgaaagtgttaggcactatcatattagtccttggaagaattcaaattaaga 51301055  T
Q  367 aagaaagaaaattc-aaagtatctgtcgtttgtcaagttatttctaaggtaattacataatgtacacattatgtctaaattacttttttgtaagtttgca 465  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||||||||||||||||||  ||||    
T  51301054 aagaaagaaaattcaaaagtatctgtcgtttgtcaagttatttctaaggtaattacataatgtaaacatattgtctaaattacttttttgtaagaatgca 51300955  T
Q  466 tattcattaattgctatgtgttatgtttaatataactgaacacacatgcaatttaaattaactttacctatatt 539  Q
    ||||||||||||||||||||||||||| || | ||||||||| |  ||||||||||| |||||| ||| |||||    
T  51300954 tattcattaattgctatgtgttatgttcaa-aaaactgaacaaaactgcaatttaaactaacttaaccaatatt 51300882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 43202435 - 43202382
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctt 69  Q
    |||||||||| || |||||| ||||||||||||||||||||||||| |||||||    
T  43202435 ctcttttatggtaagcttaaccagtgcccgggggcaccggttagcaggaccctt 43202382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 54054665 - 54054725
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttatttattt 77  Q
    |||||||| ||||||||| |||||||| ||||||||||||| ||| |||||||||||||||    
T  54054665 cttttatggtatgcttaaccagtgccccgggggcaccggttggcaggacccttatttattt 54054725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 53004008 - 53003954
Alignment:
Q  16 ctcttttatgatatgcttaatcagtg-cccgggggcaccggttagcatgaccctt 69  Q
    |||||||||||||||||||||||||| ||| ||| |||||||||||| |||||||    
T  53004008 ctcttttatgatatgcttaatcagtgtccccgggacaccggttagcaggaccctt 53003954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 50619222 - 50619274
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||| |||||||| |||||||||||||||  ||||||||    
T  50619222 cttttatggtatgcttaaccagtgcccaggggcaccggttagcgggaccctta 50619274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 16536185 - 16536240
Alignment:
Q  19 ttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttattt 73  Q
    ||||||| ||| ||||| |||||||| ||||||||||||||||| |||||||||||    
T  16536185 ttttatggtattcttaaccagtgccccgggggcaccggttagcaggacccttattt 16536240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 16820988 - 16821039
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccct 68  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| ||||||    
T  16820988 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccct 16821039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 29591325 - 29591380
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttatt 72  Q
    |||||||| |||||||||  ||||||| ||||||||||||||||| ||||||||||    
T  29591325 cttttatggtatgcttaactagtgccccgggggcaccggttagcaggacccttatt 29591380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 27 - 70
Target Start/End: Original strand, 34151267 - 34151310
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    ||||||||| | ||||||||| ||||||||||||||||||||||    
T  34151267 tatgcttaacccgtgcccgggagcaccggttagcatgaccctta 34151310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 11893441 - 11893400
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgaccct 68  Q
    ||||||||| |||||||| || ||||||||||||||||||||    
T  11893441 tatgcttaaccagtgccccggagcaccggttagcatgaccct 11893400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 43944647 - 43944692
Alignment:
Q  22 tatgatatgcttaatcagtgcccgggggcaccggttagcatgaccc 67  Q
    |||| ||||||||| ||||||||| ||||||||||||||| |||||    
T  43944647 tatggtatgcttaaccagtgcccgagggcaccggttagcaagaccc 43944692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 54655928 - 54655883
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagca 61  Q
    |||| ||||||||||||||| ||||| || ||||||||||||||||    
T  54655928 ctctcttatgatatgcttaaccagtgtcccggggcaccggttagca 54655883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 4089276 - 4089336
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccg-ggggcaccggttagcatgacccttatttat 75  Q
    |||||||||| |||| |||| ||||||||  |||||||| ||||||| |||||||||||||    
T  4089276 ctcttttatggtatgtttaaccagtgccccaggggcaccagttagcaggacccttatttat 4089336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 12356378 - 12356430
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgc-ccgggggcaccggttagcatgaccc 67  Q
    |||||||||| ||||||||| |||||  ||||||||||||||||||| |||||    
T  12356378 ctcttttatggtatgcttaaccagtgttccgggggcaccggttagcaggaccc 12356430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 31 - 66
Target Start/End: Complemental strand, 16572524 - 16572488
Alignment:
Q  31 cttaatcagtgccc-gggggcaccggttagcatgacc 66  Q
    |||||||||||||| ||||||||||||||||||||||    
T  16572524 cttaatcagtgccccgggggcaccggttagcatgacc 16572488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 20553067 - 20553127
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttatttattt 77  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| |||||||||||||||    
T  20553067 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggacccttatttattt 20553127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 34442582 - 34442531
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctt 69  Q
    |||||||| ||||||||| ||||||||||||||| ||||||||| |||||||    
T  34442582 cttttatggtatgcttaaccagtgcccgggggcatcggttagcaggaccctt 34442531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 31438782 - 31438840
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccggggg-caccggttagcatgacccttatttat 75  Q
    |||||||| ||||||||| |||||||| |||| |||||||||||| |||||||||||||    
T  31438782 cttttatggtatgcttaaccagtgccccggggacaccggttagcaggacccttatttat 31438840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 22887884 - 22887936
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgc-ccgggggcaccggttagcatgaccc 67  Q
    |||||||||| ||||||||| |||||| |||||||||||| ||||||||||||    
T  22887884 ctcttttatggtatgcttaaccagtgctccgggggcaccgattagcatgaccc 22887936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 30486346 - 30486396
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccc 67  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| |||||    
T  30486346 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc 30486396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 4022529 - 4022480
Alignment:
Q  18 cttttatgatatgcttaatcagtg-cccgggggcaccggttagcatgacc 66  Q
    ||||||||||||| |||| ||||| |||||||||||||||||||| ||||    
T  4022529 cttttatgatatgtttaaccagtgtcccgggggcaccggttagcaggacc 4022480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 27988549 - 27988499
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccct 68  Q
    |||||||| ||||||||| ||||||||||||||||||||||||| ||||||    
T  27988549 cttttatggtatgcttaaccagtgcccgggggcaccggttagcaggaccct 27988499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 28045851 - 28045801
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccct 68  Q
    |||||||| ||||||||| ||||||||||||||||||||||||| ||||||    
T  28045851 cttttatggtatgcttaaccagtgcccgggggcaccggttagcaggaccct 28045801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 27 - 72
Target Start/End: Complemental strand, 42655317 - 42655272
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgacccttatt 72  Q
    ||||||||| | |||||| |||||||||||||||||||||||||||    
T  42655317 tatgcttaaccggtgccctggggcaccggttagcatgacccttatt 42655272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 27 - 73
Target Start/End: Complemental strand, 2490198 - 2490151
Alignment:
Q  27 tatgcttaatcagtgcc-cgggggcaccggttagcatgacccttattt 73  Q
    ||||||||| | ||||| ||||||||||||||||||||||||||||||    
T  2490198 tatgcttaacccgtgcctcgggggcaccggttagcatgacccttattt 2490151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 13643145 - 13643204
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggg-gcaccggttagcatgacccttattta 74  Q
    |||||||||| ||||||||| ||||||||  || ||||||||||||| ||||||||||||    
T  13643145 ctcttttatggtatgcttaaccagtgccctaggagcaccggttagcaggacccttattta 13643204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 13743570 - 13743629
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggg-gcaccggttagcatgacccttattta 74  Q
    |||||||||| ||||||||| ||||||||  || ||||||||||||| ||||||||||||    
T  13743570 ctcttttatggtatgcttaaccagtgccctaggagcaccggttagcaggacccttattta 13743629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 28626904 - 28626947
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagca 61  Q
    |||||||| ||||||||||||||| ||||| |||||||||||||    
T  28626904 cttttatggtatgcttaatcagtgtccgggagcaccggttagca 28626947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 34228818 - 34228868
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccc 67  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| |||||    
T  34228818 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc 34228868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 16 - 59
Target Start/End: Complemental strand, 7304570 - 7304526
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgc-ccgggggcaccggttag 59  Q
    |||||||||| ||||||||| |||||| |||||||||||||||||    
T  7304570 ctcttttatggtatgcttaaccagtgctccgggggcaccggttag 7304526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 16394113 - 16394061
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccc 67  Q
    |||||||||| ||||||||| || ||||| ||||||||||||||||| |||||    
T  16394113 ctcttttatggtatgcttaaccaatgccccgggggcaccggttagcaggaccc 16394061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 16 - 67
Target Start/End: Complemental strand, 20831605 - 20831553
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgc-ccgggggcaccggttagcatgaccc 67  Q
    |||||||||| |||||||||||||||| || ||| |||||||||||| |||||    
T  20831605 ctcttttatggtatgcttaatcagtgctcccgggacaccggttagcaggaccc 20831553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 30675623 - 30675567
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccggggg-caccggttagcatgacccttattt 73  Q
    |||||||| ||||||||| |||||||| |||| |||||||||||| |||| ||||||    
T  30675623 cttttatggtatgcttaaccagtgccccggggacaccggttagcaggacctttattt 30675567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 34650883 - 34650823
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttatttattt 77  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| |||||| ||||||||    
T  34650883 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccctaatttattt 34650823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 35504290 - 35504238
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||| | ||| ||||||||||||||||||| ||||||||    
T  35504290 cttttatggtatgcttaacccgtgtccgggggcaccggttagcaggaccctta 35504238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 35132655 - 35132709
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctt 69  Q
    |||||||||| ||||||||| || ||||| ||||||||||||||||| |||||||    
T  35132655 ctcttttatggtatgcttaaccaatgccccgggggcaccggttagcaggaccctt 35132709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 5694457 - 5694513
Alignment:
Q  18 cttttatgatatgcttaatcagtgc-ccgggggcaccggttagcatgacccttattt 73  Q
    |||||||| ||||||||| |||||| ||||||||||||||||||| |||||||||||    
T  5694457 cttttatggtatgcttaaccagtgctccgggggcaccggttagcaggacccttattt 5694513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 29657907 - 29657960
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| ||||||||    
T  29657907 cttttatggtatgcttaaccagtgccctgggggcaccggttagcaggaccctta 29657960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 18043299 - 18043351
Alignment:
Q  19 ttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctta 70  Q
    ||||||| ||||||||| |||||||| ||||||||||||||||| ||||||||    
T  18043299 ttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccctta 18043351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 29210530 - 29210581
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccct 68  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| ||||||    
T  29210530 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccct 29210581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 69
Target Start/End: Complemental strand, 14350319 - 14350277
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgaccctt 69  Q
    ||||||||| |||||||| |||||||||||||||| |||||||    
T  14350319 tatgcttaaccagtgccccggggcaccggttagcaggaccctt 14350277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 15227875 - 15227929
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccggg-ggcaccggttagcatgacccttat 71  Q
    |||||||| ||||||||| |||||||| || |||||||||||||| |||||||||    
T  15227875 cttttatggtatgcttaaccagtgccccggaggcaccggttagcaagacccttat 15227929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 47010127 - 47010181
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgc-ccgggggcaccggttagcatgaccctt 69  Q
    |||||||||| ||||||||| |||||| || |||||||||||||||| |||||||    
T  47010127 ctcttttatggtatgcttaaccagtgctccaggggcaccggttagcaggaccctt 47010181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 51065798 - 51065745
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccg-ggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||| ||||||||  |||||||||||||||| ||||||||    
T  51065798 cttttatggtatgcttaaccagtgccccaggggcaccggttagcaggaccctta 51065745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 17333426 - 17333462
Alignment:
Q  26 atatgcttaatcagtgcccgggggcaccggttagcat 62  Q
    |||| ||||| ||||||||||||||||||||||||||    
T  17333426 atatccttaaccagtgcccgggggcaccggttagcat 17333462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 38162986 - 38163046
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttatttattt 77  Q
    |||||||| ||||||||| | |||||| ||||||||||||||||| |||| || |||||||    
T  38162986 cttttatggtatgcttaacccgtgccccgggggcaccggttagcaggacctttttttattt 38163046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 42770039 - 42769987
Alignment:
Q  19 ttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctta 70  Q
    ||||||| ||||||||| |||||||| |||||||||||||||||  |||||||    
T  42770039 ttttatggtatgcttaaccagtgccccgggggcaccggttagcagaaccctta 42769987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 27 - 70
Target Start/End: Original strand, 19434639 - 19434682
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    ||||||||| |||||||||||||||||||| |||||||||||||    
T  19434639 tatgcttaaccagtgcccgggggcaccggtcagcatgaccctta 19434682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 42044343 - 42044293
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccct 68  Q
    |||||||| |||| |||| |||||||| |||||||||||||||||||||||    
T  42044343 cttttatggtatgtttaaccagtgccccggggcaccggttagcatgaccct 42044293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 11686374 - 11686324
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagcatgacc 66  Q
    |||||||||||||||||||| | || ||||| |||||||||||||| ||||    
T  11686374 ctcttttatgatatgcttaacctgtacccggaggcaccggttagcaggacc 11686324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 12218488 - 12218434
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    |||||||||| |||| |||| |||||||| ||| |||||||||||| ||||||||    
T  12218488 ctcttttatggtatgtttaaccagtgccccgggacaccggttagcaggaccctta 12218434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 24438613 - 24438663
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccc 67  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| |||||    
T  24438613 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc 24438663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 73
Target Start/End: Complemental strand, 34556931 - 34556886
Alignment:
Q  27 tatgcttaatcagtgcccgggggcaccggttagcatgacccttattt 73  Q
    ||||||||| |||||||||||| ||||||||||||||||||| ||||    
T  34556931 tatgcttaaccagtgcccgggg-caccggttagcatgaccctaattt 34556886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 24798559 - 24798607
Alignment:
Q  38 agtgcccgggggcaccggttagcatgacccttatttatttcatgcttct 86  Q
    |||||||||||||||||||||||||  ||||||||| ||| ||| ||||    
T  24798559 agtgcccgggggcaccggttagcatttcccttatttttttaatgattct 24798607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 7)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 392230 - 392285
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctta 70  Q
    |||||||||| ||||||||| |||||||| ||||||||||||||||| ||||||||    
T  392230 ctcttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccctta 392285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 35044023 - 35044074
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccc 67  Q
    |||||||||| ||||||||| |||||||| ||||||||||||| ||||||||    
T  35044023 ctcttttatggtatgcttaaccagtgccccggggcaccggttaacatgaccc 35044074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 70
Target Start/End: Complemental strand, 13417011 - 13416957
Alignment:
Q  16 ctcttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    ||||||||| |||||||||| |||||||||| |||||||||||||  ||||||||    
T  13417011 ctcttttataatatgcttaaccagtgcccggaggcaccggttagctggaccctta 13416957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 32929558 - 32929505
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||| |||||||| ||||||||||||||||| ||||||||    
T  32929558 cttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccctta 32929505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 3026061 - 3026015
Alignment:
Q  16 ctcttttatgatatgcttaatcagtg-cccgggggcaccggttagca 61  Q
    |||||||||| ||||||||||||||| |||| |||||||||||||||    
T  3026061 ctcttttatggtatgcttaatcagtgtcccgagggcaccggttagca 3026015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 29978368 - 29978420
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccctta 70  Q
    |||||||||||||||||| ||| |||| ||  |||||||||||| ||||||||    
T  29978368 cttttatgatatgcttaaccagcgccctggaacaccggttagcaggaccctta 29978420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 32985243 - 32985199
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagca 61  Q
    |||||||| ||||||||| |||||||| |||||||||||||||||    
T  32985243 cttttatggtatgcttaaccagtgccccgggggcaccggttagca 32985199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000005; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 43787008 - 43787063
Alignment:
Q  19 ttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttattt 73  Q
    ||||||| ||||||||| |||||||| ||||||||||||||||| |||||||||||    
T  43787008 ttttatggtatgcttaaccagtgccccgggggcaccggttagcaggacccttattt 43787063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 7468546 - 7468595
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccgggggcaccggttagcatgaccc 67  Q
    |||||||| |||||||||||||||||| || ||||||||||||| |||||    
T  7468546 cttttatggtatgcttaatcagtgccccggagcaccggttagcaggaccc 7468595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 18014808 - 18014861
Alignment:
Q  18 cttttatgatatgcttaatcagtg-cccgggggcaccggttagcatgaccctta 70  Q
    |||||||| ||||||||||||||| |||||||||||| ||||||| ||||||||    
T  18014808 cttttatggtatgcttaatcagtgccccgggggcaccagttagcaagaccctta 18014861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 52520818 - 52520874
Alignment:
Q  19 ttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgacccttattta 74  Q
    ||||||| ||||||||| |||||||| ||||||||||||||||| ||||||| ||||    
T  52520818 ttttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccctttttta 52520874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 49893467 - 49893510
Alignment:
Q  18 cttttatgatatgcttaatcagtg-cccgggggcaccggttagc 60  Q
    |||||||| ||||||||||||||| |||||||||||||||||||    
T  49893467 cttttatggtatgcttaatcagtgccccgggggcaccggttagc 49893510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 272356 - 272406
Alignment:
Q  18 cttttatgatatgcttaatcagtgccc-gggggcaccggttagcatgaccc 67  Q
    |||||||| ||||||||||| |||||| ||||||||||||||||| |||||    
T  272356 cttttatggtatgcttaatcggtgccccgggggcaccggttagcaggaccc 272406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 39074554 - 39074608
Alignment:
Q  18 cttttatgatatgcttaatcagtgcccg-ggggcaccggttagcatgacccttat 71  Q
    |||||||| ||||||||| ||||||||  |||||||||||||||| |||||||||    
T  39074554 cttttatggtatgcttaaccagtgccccaggggcaccggttagcaggacccttat 39074608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University