View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1783_high_57 (Length: 286)

Name: NF1783_high_57
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1783_high_57
NF1783_high_57
[»] chr5 (3 HSPs)
chr5 (1-267)||(41796351-41796615)
chr5 (1-73)||(41762568-41762640)
chr5 (1-54)||(41792856-41792909)


Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 41796615 - 41796351
Alignment:
1 ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggcattattggattatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41796615 ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggcattattggattatc 41796516  T
101 ggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattggtctgaccaattattttctaccatatc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
41796515 ggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattgatctgaccaattattttctaccatatc 41796416  T
201 tatgtctatagttttatacgattctctgtttcagggtaagatttctatatacccccgttggctttgc 267  Q
      ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
41796415 --tgtctatagttttatacgattctctgtttgagggtaagatttctatatacccccgttggctttgc 41796351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 41762640 - 41762568
Alignment:
1 ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatg 73  Q
    |||||||| | || |||| ||||||||||||||||||||||||||||||||||||||  |  |||||||||||    
41762640 ccctttcaatttcaaaataaattgacttcactttagtttagaggatcacttgggatttttcctctaaatgatg 41762568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 41792909 - 41792856
Alignment:
1 ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttggg 54  Q
    |||||||| | || |||||| ||||||||||||| |||||||||||||||||||    
41792909 ccctttcaatttctaaatgatttgacttcacttttgtttagaggatcacttggg 41792856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University