View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_high_57 (Length: 286)
Name: NF1783_high_57
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 41796615 - 41796351
Alignment:
| Q |
1 |
ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggcattattggattatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796615 |
ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatgcatatgtcaaggcattattggattatc |
41796516 |
T |
 |
| Q |
101 |
ggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattggtctgaccaattattttctaccatatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41796515 |
ggccatttagatgacaaaatcttgggtctctgtcagaaataaaagtcttcattctttttgttggtaccaattgatctgaccaattattttctaccatatc |
41796416 |
T |
 |
| Q |
201 |
tatgtctatagttttatacgattctctgtttcagggtaagatttctatatacccccgttggctttgc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796415 |
--tgtctatagttttatacgattctctgtttgagggtaagatttctatatacccccgttggctttgc |
41796351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 41762640 - 41762568
Alignment:
| Q |
1 |
ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttgggattcatattctaaatgatg |
73 |
Q |
| |
|
|||||||| | || |||| |||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
41762640 |
ccctttcaatttcaaaataaattgacttcactttagtttagaggatcacttgggatttttcctctaaatgatg |
41762568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 41792909 - 41792856
Alignment:
| Q |
1 |
ccctttcagtgtccaaatgaattgacttcactttagtttagaggatcacttggg |
54 |
Q |
| |
|
|||||||| | || |||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
41792909 |
ccctttcaatttctaaatgatttgacttcacttttgtttagaggatcacttggg |
41792856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University