View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1783_high_68 (Length: 256)

Name: NF1783_high_68
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1783_high_68
NF1783_high_68
[»] chr2 (2 HSPs)
chr2 (41-242)||(43416082-43416283)
chr2 (1-45)||(43416303-43416347)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 41 - 242
Target Start/End: Complemental strand, 43416283 - 43416082
Alignment:
41 tataacactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca 140  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43416283 tatagcactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca 43416184  T
141 atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatacaacttggttaat 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43416183 atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatacaacttggttaat 43416084  T
241 ga 242  Q
    ||    
43416083 ga 43416082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 43416347 - 43416303
Alignment:
1 tttagaagaatacatcaatttttgttgactcatattctcttataa 45  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
43416347 tttagaagaatacatcaatttttgttgactcatattctcttataa 43416303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University