View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_high_92 (Length: 237)
Name: NF1783_high_92
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_high_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 102 - 222
Target Start/End: Original strand, 30864220 - 30864341
Alignment:
| Q |
102 |
ctgtttcagaggagtgaagatctcatatttacttcctgtttgacttacttttgttgcggacaacattaggtttgtttttcatgatagctttcctttttca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
30864220 |
ctgtttcagaggagtgaagatctcatatttacttcctctttgacttacttttgttgcggacaacattaggtttgttttgcataatagctttcctttttca |
30864319 |
T |
|
| Q |
202 |
tg-ttgtttaatgtatcaatct |
222 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
30864320 |
tgtttgtttaatgtatcaatct |
30864341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University