View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_high_99 (Length: 234)
Name: NF1783_high_99
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_high_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 81 - 218
Target Start/End: Complemental strand, 24059781 - 24059644
Alignment:
| Q |
81 |
caaacgcaccataaaagaatcatgaactacaccactcacactcatttcttattctttgaattagtcattcaagaggttggaagaatttatgtggattgaa |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
24059781 |
caaacgcaccctaaaagaatcatgaactacaccactcacactcatttcttattctttgaattagttttttaagaggttggaagaatttatgtggattgaa |
24059682 |
T |
 |
| Q |
181 |
gctgattctcgattcacgattcaagtttataagagaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24059681 |
gctgattctcgattcacgattcaagtttataagagaat |
24059644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University