View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_101 (Length: 233)
Name: NF1783_low_101
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_101 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 32270767 - 32270535
Alignment:
| Q |
1 |
tttttaggtgtatatacactcagataggggtatatcaaacatcttattgtaattatgctgcaggaggtagccgtatatgagaggtcccttgtgagctgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32270767 |
tttttaggtgtatatacactcagataggcgtatatcaaacatcttattgtaattatgctgcaggaggtagccgtatatgagaggtcccttgtgagctgta |
32270668 |
T |
 |
| Q |
101 |
tgattttgaaagagcaaatatgcaaagaaacaaagataaagtgttatgagactctttccactttttaaagttgtccctttgtgttgaaacttctttttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32270667 |
tgattttgaaagagcaaatatgcaaagaaacaaagataaagtgttatgagactctttccacttcttaaagttgtccctttgtgttgaaacttctttttta |
32270568 |
T |
 |
| Q |
201 |
atcattcaagatcaagtacttcttctttttcaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32270567 |
atcattcaagatcaagtacttcttctttttcaa |
32270535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University