View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_103 (Length: 231)
Name: NF1783_low_103
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_103 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 33739994 - 33740210
Alignment:
| Q |
1 |
ccttgtacggcggagattgtctgataatgatggtgctccggcgccgctgaagtcacagcggatgaggaagtgacagcaacatggttagtacgagagcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33739994 |
ccttgtacggcggagattgtctgataatgatggtgctccggcgccgctgaagtcacagcggatgaggaagtgacagcaacatgattagtacgagagcgtt |
33740093 |
T |
 |
| Q |
101 |
tggcgttttttctggtaccaccaccgacagggatgtcacggagggttccaccgtgagtccagtagcggcggcaagctttgcagaaatgacgtggctgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33740094 |
tggcgttttttctggtaccaccaccgacagggatgtcacggagggttccaccgtgagtccagtagcggcggcaagctttgcagaaatgacgtggctgaga |
33740193 |
T |
 |
| Q |
201 |
gtagttgtagttgttgt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33740194 |
gtagttgtagttgttgt |
33740210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 24563400 - 24563340
Alignment:
| Q |
157 |
gtccagtagcggcggcaagctttgcagaaatgacgtggctgagagtagttgtagttgttgt |
217 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24563400 |
gtccagtagcgacggcagtttttacagaaatgacgaggctgagagaggttgtagttgttgt |
24563340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University