View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_105 (Length: 227)
Name: NF1783_low_105
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_105 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 45168749 - 45168609
Alignment:
| Q |
1 |
ggttcaccgtaaaaagagagaaatgaatccacattttgagaaaggctcttttgggtccaatcaaaatgaaaaagaccccattttgatccccacaaagtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45168749 |
ggttcaccgtaaaaagagagaaatgaatccacattttaagaaaggctgttttgggtccaatcaaaatgaaaaagaccccattttgatccccacaaaatga |
45168650 |
T |
 |
| Q |
101 |
gaaaagcatgttctta-ccctctagatatgatgtacgaggg |
140 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
45168649 |
gaaaagcatgttcttacccctctagatatgatgtaagaggg |
45168609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University