View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_109 (Length: 225)
Name: NF1783_low_109
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_109 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 6594136 - 6594336
Alignment:
| Q |
12 |
gagaagaattgatgagctggacttggagtgtagaacgggaataacggagatcgcttaacggtttctgtttcgttagagttttcgccattgacagtgacgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6594136 |
gagaagaattgatgagctggacttggagtgtagaacgggaataacggagatcgcttaacggtttctgtttcgttagagttttcgccattgacagtgacgg |
6594235 |
T |
 |
| Q |
112 |
agtttgtgtgaggttcagaacttccgttaagtgtgacggagttttgttgaggaagttcagtgttgaaattgcgagaggaatgagtgagagtttttgaagt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6594236 |
agtttgtgtgaggttcagaacttccgttaagtgtgacggagttttgttgaggaagttcagtgttgaaattgcgagaggaatgagtgagattttttgaagt |
6594335 |
T |
 |
| Q |
212 |
g |
212 |
Q |
| |
|
| |
|
|
| T |
6594336 |
g |
6594336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University