View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_110 (Length: 225)
Name: NF1783_low_110
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_110 |
 |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0252 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 28 - 185
Target Start/End: Complemental strand, 23579 - 23422
Alignment:
| Q |
28 |
ataagtcacgacaatccttaatattttaaaaattatggataagtctaacgcgttaccaaaaatcggtttgtgaggtgaagattatccccacttgtataca |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23579 |
ataagtcacgacaatccctaatattttaaaaattgtcgataagtctaacgcgttaccaaaaatcggtttgtgaggtgaagattatccccacttatataca |
23480 |
T |
 |
| Q |
128 |
nnnnnnnaagaaacttatatgcacatttttagatcatctctcatcaaacataggactc |
185 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23479 |
tttttttaaggaacttatatgcacatttttagatcatctctcatcaaacataggactc |
23422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University