View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_114 (Length: 215)
Name: NF1783_low_114
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_114 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 2 - 162
Target Start/End: Complemental strand, 29152265 - 29152105
Alignment:
| Q |
2 |
gtagatctcaccatgaataatactcaacnnnnnnnctaattaattatcgtggtttctgacaccgctcattccaaatattaaagcaaaacgcagcacattt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29152265 |
gtagatctcaccatgaataatactcaacaaaaaaactaattaattatcgtggtttctgacaccactcattccaaatattaaagcaaaacgcagcacattt |
29152166 |
T |
|
| Q |
102 |
atactactacagtatacccataaatacaaggacttgtttttgtggtgctcagtttcttatt |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
29152165 |
atactactacagtatacccataaatataaggacttgtatttatggtgctcagtttcttatt |
29152105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University