View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_21 (Length: 471)
Name: NF1783_low_21
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 183 - 466
Target Start/End: Original strand, 41705459 - 41705742
Alignment:
| Q |
183 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705459 |
cttcaacctcggaccccactcccaacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgt |
41705558 |
T |
 |
| Q |
283 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705559 |
gaattaaaacccaagcttacctcggatccctctccccctaccaacatctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacaca |
41705658 |
T |
 |
| Q |
383 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatctcact |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705659 |
gttccaccccctcttccgatctatgcacaatggctcattgccctttagactccattgaaaccaaagactgcggttcatttcact |
41705742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41705277 - 41705339
Alignment:
| Q |
1 |
tcttcatctcaaatgctactattccctctaccacaccccctctccataatagaatccaacaca |
63 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||| | |||||||| ||||||| ||||||| |
|
|
| T |
41705277 |
tcttcatctcaaatgctactattacctctaacacactcactctccatgatagaattcaacaca |
41705339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 205 - 285
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
205 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
285 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University