View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_26 (Length: 422)
Name: NF1783_low_26
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 1 - 402
Target Start/End: Original strand, 34331601 - 34332002
Alignment:
| Q |
1 |
ttcattttgtttggactttagagtataatgcaagtgttgtttatgatgataaattagacaagtcttgcagtgatatttcccatcacgaacgtggcaaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331601 |
ttcattttgtttggactttagagtataatgcaagtgttgtttatgatgataaattagacaagtcttgcagtgatatttcccatcacgaacgtggcaaacc |
34331700 |
T |
 |
| Q |
101 |
ctttaattttgcctaggcatgaccatgatgattgatgatcaaaactcagtcactcactcatgaatgatcaaaaattgatacatcgttacaattttgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331701 |
ctttaattttgcctaggcatgaccatgatgattgatgatcaaaactcactcactcatgaatgaatgatcaaaaattgatacatcgttacaattttgtttt |
34331800 |
T |
 |
| Q |
201 |
gttgcacttgcacatgcatgatgcacatgaccttatagcttaattaaagcttgcaacattggtgctactagcttgatcacgcttcctactaatacaagat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331801 |
gttgcacttgcacatgcatgatgcacatgaccttatagcttaattaaagcttgcaacattggtgctactagcttgatcacgcttcctactaatacaagat |
34331900 |
T |
 |
| Q |
301 |
ttcttgatatgtcactgtggggtcactcaccctttgcttgatagaaggaaaaatagaaagccttcaccaatgaggcaccattttgtatggaccccgagtc |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331901 |
ttcttgatatgtcactgtggggtcacccaccctttgcttgatagaaggaaaaatagaaagccttcaccaatgaggcaccattttgtatggaccccgagtc |
34332000 |
T |
 |
| Q |
401 |
ct |
402 |
Q |
| |
|
|| |
|
|
| T |
34332001 |
ct |
34332002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University