View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_35 (Length: 371)
Name: NF1783_low_35
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 348; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 356
Target Start/End: Complemental strand, 42087736 - 42087381
Alignment:
| Q |
1 |
aagggtttaaaggaaaaaatgttgaaagcatgagttgcttggagacacctcagaattcaaagaagaaaaacaagaagatagaaaacaagagaaggtttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087736 |
aagggtttaaaggaaaaaatgttgaaagcatgagttgcttagagacacctcagaattcaaagaagaaaaacaagaagatagaaaacaagagaaggtttag |
42087637 |
T |
 |
| Q |
101 |
tgatgaacagataagatcactagaatgcatatttgagtcagaatcaaagttggaaccaaggaagaagatgcaacttgcaagagatcttggtttgcagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087636 |
tgatgaacagataagatcactagaatgcatatttgagtcagaatcaaagttggaaccaaggaagaagatgcaacttgcaagagatcttggtttgcagcct |
42087537 |
T |
 |
| Q |
201 |
agacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaaaaggatagaacaagaatacagaaaactcaaagatgattatgataatttag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42087536 |
agacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaaaaggatagaacaagaatacagaaaactcaaagatgaatatgataatttag |
42087437 |
T |
 |
| Q |
301 |
cttctaagtttcagtgccttaaggaagagaaagagtctttgcaatcagaggtaagt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087436 |
cttctaagtttcagtgccttaaggaagagaaagagtctttgcaatcagaggtaagt |
42087381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 244
Target Start/End: Original strand, 39342692 - 39342750
Alignment:
| Q |
186 |
cttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaa |
244 |
Q |
| |
|
||||| ||||||||||||||||| ||| | ||||| || ||||| |||||||||||||| |
|
|
| T |
39342692 |
cttgggttgcagcctagacaagtagctgtttggttccaaaacaggagagcaagatggaa |
39342750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 153 - 250
Target Start/End: Original strand, 9379021 - 9379118
Alignment:
| Q |
153 |
gaaccaaggaagaagatgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaa |
250 |
Q |
| |
|
|||||||| |||||| |||| | || ||||| ||||| |||||||| ||||||||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
9379021 |
gaaccaagaaagaagttgcagttagctagagagcttggattgcagccaagacaagttgctatatggtttcaaaacaaaagagctagatggaaatcaaa |
9379118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 24692455 - 24692391
Alignment:
| Q |
168 |
atgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaag |
232 |
Q |
| |
|
||||| || ||||||| |||||| |||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
24692455 |
atgcagctagcaagagctcttggattgcagccaagacaaattgctatatggtttcaaaacagaag |
24692391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 16763066 - 16762999
Alignment:
| Q |
171 |
caacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaag |
238 |
Q |
| |
|
|||||||||| ||| ||||||||||| || ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
16763066 |
caacttgcaaaagagcttggtttgcaaccaagacaagttgctatatggtttcaaaacagaagggcaag |
16762999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 168 - 244
Target Start/End: Complemental strand, 17181983 - 17181907
Alignment:
| Q |
168 |
atgcaacttgcaagagatcttggtttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaa |
244 |
Q |
| |
|
||||| |||||||||| |||| ||||| |||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
17181983 |
atgcagcttgcaagagctcttaacttgcaacctagacaagttgctatatggtttcaaaatagaagggcaagatggaa |
17181907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 250
Target Start/End: Complemental strand, 2342836 - 2342778
Alignment:
| Q |
192 |
ttgcagcctagacaagttgctatatggtttcagaacagaagagcaagatggaaatcaaa |
250 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
2342836 |
ttgcagcctagacaaattgctatatggtttcagaatagaagagcaagatgcaaaacaaa |
2342778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University