View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_44 (Length: 337)
Name: NF1783_low_44
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 50634975 - 50634772
Alignment:
| Q |
18 |
agtaaaacactcaactaaaaaattgcttggttctcgagggttgagtgatgaatgtgaagtcataaataaattatagtttataagctaaataagtaatact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50634975 |
agtaaaacactcaactaaaaaattgcttggttctcgagggttgagtgatgaatgtgaagtcataaataaattatagtttataagctaaataagtaatact |
50634876 |
T |
|
| Q |
118 |
tgtactattcaatgactaagtaagtaagtattcgatcaaccttgaggcatatgctaattagacgagttgaactttaatctattaaatactatcactcttt |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50634875 |
tgtactattcaatgactaagta----agtattcgatcaaccttgaggcatatggtaattagacgagttgaactttaatctattaaatactatcactcttt |
50634780 |
T |
|
| Q |
218 |
tttgacga |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
50634779 |
tttgacga |
50634772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 224 - 330
Target Start/End: Complemental strand, 50634604 - 50634498
Alignment:
| Q |
224 |
gaaaacaaccacgacacatatgtcatagaaagttcttaactttgggagatatttttaacttgcataccaaatttcatcgaccagctatatgcatatgaga |
323 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
50634604 |
gaaaacaaccacgatacacatgtcatagaaagttcttaactttgggagatatttttaacttgcatatcgaatttcatcgaccagctatatgcatatgaga |
50634505 |
T |
|
| Q |
324 |
ataatct |
330 |
Q |
| |
|
|| |||| |
|
|
| T |
50634504 |
attatct |
50634498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University