View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_51 (Length: 324)
Name: NF1783_low_51
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 16 - 172
Target Start/End: Original strand, 15292493 - 15292649
Alignment:
| Q |
16 |
gaaatctcaaaatacattgagttaatcttttagttaaatggattagacacagaagaaaattttacagcagcgttacatcaaactcaatctctccttaacg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15292493 |
gaaatctcaaaatacattgagttaatcttttagttaaatggtttagacacagaagaaaattttatagcagcgttacatcaaactcaatctctccttaacg |
15292592 |
T |
|
| Q |
116 |
accgtttgcattcgtttattttttcgccnnnnnnntctggaagcaaggacaaagcct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15292593 |
accgtttgcattcgtttattttttcgccaaaaaaatctggaagcaaggacaaagcct |
15292649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 199 - 312
Target Start/End: Original strand, 15292676 - 15292789
Alignment:
| Q |
199 |
ccctaaaacctgaggaatgcggttgttcatgctagattattagcaacaacattagtagtgtgctaaatcttaataaacattcatgttcaaacttttgtat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15292676 |
ccctaaaacctgaggaatgcggttgttcatgctagattattagcaacaacattagtagtgtgctaaatcttaataaacattcatgttcaaacttttgtat |
15292775 |
T |
|
| Q |
299 |
atcttgatcatatt |
312 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15292776 |
atcttgatcatatt |
15292789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University