View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_56 (Length: 296)
Name: NF1783_low_56
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 80 - 208
Target Start/End: Complemental strand, 14985935 - 14985805
Alignment:
| Q |
80 |
atgcccgtttttagagt--aataataacttttcttgaaattgttgtcaaggattatttttctattagaatggcattctctttttgttgttgatttagatg |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14985935 |
atgcccgtttttagagtgtaataataacttttcttgaaattgttgtcaaggattatttttctattagaatggcattctctttttgttgttgatttagata |
14985836 |
T |
 |
| Q |
178 |
attttttacatgtaagaactgtgttgtcttt |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |
|
|
| T |
14985835 |
attttttacatgtaagaactatgttgtcttt |
14985805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 202 - 281
Target Start/End: Complemental strand, 14985775 - 14985696
Alignment:
| Q |
202 |
tgtctttttaataagaactttcatagctagaacggcaaaagaaaattagttaacgatgaattcaatgaaatacaaatact |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14985775 |
tgtctttttaataagaactttcatagctagaacggcaaaagaaaattagttaacgatgaattcaatgaaatacaaatact |
14985696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 14986507 - 14986432
Alignment:
| Q |
1 |
cagggttccaaagaatctcatacaaaatgatctttttccaagattacccaaataagcaagatcacttctacatgga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14986507 |
cagggttccaaagaatctcatacaaaatgatctttttccaagattacccaaataagcaagatcacttctacatgga |
14986432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University