View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_65 (Length: 269)
Name: NF1783_low_65
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 265
Target Start/End: Complemental strand, 33107688 - 33107442
Alignment:
| Q |
19 |
tcaacagccattttgattctcattccaggacaccaagtaacactcatcgccgcatccacaacttccgctttcaacacaaaatccgaccaccctgctctcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107688 |
tcaacagccattttgattctcattccaggacaccaagtaacactcatcgccgcatccacaacctccgctttcaacacaaaatccgaccaccctgctctcg |
33107589 |
T |
 |
| Q |
119 |
gataatacaccacttcaaaccccatcccttgagccgccatttccgccgcctccgcaaccgccaccggagacaacttccccttcccgtgcctcgaaaatgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107588 |
gataatacaccacttcaaaccccatcccctgagccgccatttccgccgcctccgcaactgccaccggagacaacttccccttcccgtgcctcgaaaatgc |
33107489 |
T |
 |
| Q |
219 |
cttctcttccaccagcttctcttcatcatccacccttcttctcactc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33107488 |
cttctcttccaccagcttctcttcatcatccaccctacttctcactc |
33107442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University