View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_68 (Length: 256)
Name: NF1783_low_68
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 239
Target Start/End: Original strand, 32942330 - 32942550
Alignment:
| Q |
12 |
atgaagaaattaataaagtgatgggtacaaaaataataagtcgtgtttgttgggagacaacctacaataaattgtagttttttattccaccgcagtgtaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32942330 |
atgaagaaattaataaagtgatgggtacaaaaataataagtcgtgtttg---ggagacaacctacaataaattgtagttttttcttccaccgcagtgtaa |
32942426 |
T |
 |
| Q |
112 |
catatgtgctcatgaatagtgctactgagtttgaacctattttgagggatgggggtatttggtgttaggagtctaaaaactgtgtgctgttttccaacta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32942427 |
catatgtgctcatgaatagtgctactgagtttgaacctattttgagggatgggggtatttggtgttaggagtctaaaaactgtgtgctgttttccaact- |
32942525 |
T |
 |
| Q |
212 |
tacatacttttatcataacaccatttta |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32942526 |
---atacttttatcataacaccatttta |
32942550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University