View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_69 (Length: 256)
Name: NF1783_low_69
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 41 - 242
Target Start/End: Complemental strand, 43416283 - 43416082
Alignment:
| Q |
41 |
tataacactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca |
140 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416283 |
tatagcactaacatttcagattgaaagcgttatatgcgtgtctgtgtccggtgttgatgtttcatagtcgataactggatggataagcaaaatcaaagca |
43416184 |
T |
|
| Q |
141 |
atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatacaacttggttaat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416183 |
atctattgaagaacatgttgcaaaaacaagtagaaaaagacactactgatattcatggatgttgccttcaacaacattgccatcatacaacttggttaat |
43416084 |
T |
|
| Q |
241 |
ga |
242 |
Q |
| |
|
|| |
|
|
| T |
43416083 |
ga |
43416082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 43416347 - 43416303
Alignment:
| Q |
1 |
tttagaagaatacatcaatttttgttgactcatattctcttataa |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416347 |
tttagaagaatacatcaatttttgttgactcatattctcttataa |
43416303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University