View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_73 (Length: 252)
Name: NF1783_low_73
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 55076865 - 55076637
Alignment:
| Q |
8 |
agcaaaggaagaaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076865 |
agcaaaggaagaaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga |
55076766 |
T |
 |
| Q |
108 |
aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55076765 |
aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattctac |
55076666 |
T |
 |
| Q |
208 |
ggtgatcaccggcagcaaggtcaccaagg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55076665 |
ggtgatcaccggcagcaaggtcaccaagg |
55076637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 234
Target Start/End: Original strand, 15125312 - 15125414
Alignment:
| Q |
132 |
gagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcac |
231 |
Q |
| |
|
||||| || ||||||||||||| ||| || ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15125312 |
gagccagcagcataaccaaggacattaccgacggccatgaaaaaagagaacatcccattgccaattctcattcgacggtgatcaccaccagcgaggtcac |
15125411 |
T |
 |
| Q |
232 |
caa |
234 |
Q |
| |
|
||| |
|
|
| T |
15125412 |
caa |
15125414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 169
Target Start/End: Original strand, 43665606 - 43665688
Alignment:
| Q |
87 |
gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat |
169 |
Q |
| |
|
||||| |||| |||||| ||||||| |||| ||||||||||| ||| |||||||| ||||| ||||| || || |||||||| |
|
|
| T |
43665606 |
gcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat |
43665688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University