View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_75 (Length: 251)
Name: NF1783_low_75
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 32269773 - 32269940
Alignment:
| Q |
1 |
cagtagaccacattccatgtttacaaattatatccgcat--gaaatctccacactcaatcataccgatccaacggccacaatctcactgaaatcacaaaa |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| || ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32269773 |
cagtagaccacattccatgattacaaattatatccccatatgaaatctccacactcaatcacactgatccaacggccaaaatctcactaaaatcacaaaa |
32269872 |
T |
|
| Q |
99 |
caacatgaggcaatgcaaatgcttatgatctataacaactataaaataggaatgatagttatactaaa |
166 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
32269873 |
caatatgaagcaatgcaaatgcttatgatctataacaactataaaatagcaatggtagttatactaaa |
32269940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 65 - 133
Target Start/End: Original strand, 32809840 - 32809908
Alignment:
| Q |
65 |
atccaacggccacaatctcactgaaatcacaaaacaacatgaggcaatgcaaatgcttatgatctataa |
133 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32809840 |
atccaacggccacaagttcactcgaatcgcaaaacaacatgaggcaaagcaaatgcttatgatctataa |
32809908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University