View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_77 (Length: 250)
Name: NF1783_low_77
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_77 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 31520625 - 31520865
Alignment:
| Q |
13 |
aatatcaataaattatggttatgccaattttcaaggttggaatcgtggacctcttgcttaaaactcatttatagtattcttcagctcaccaaccac---a |
109 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31520625 |
aatatcaataagttatggttatgtcaattttcaaggttggaatcgtggacctcttgcttaaaactcatttatagtattcttcagctcaccaaccatcata |
31520724 |
T |
 |
| Q |
110 |
atacttattatgaacaagtcatttcttttctttgtgaacagaaacaagctacactagaatgtaacatagtgtaatggaaatgaatgcaggcatgagcggt |
209 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520725 |
atacctattatgaacaagtcaattcttttctttgtgaacagaaacaagctactctagaatataacatagtgtaatggaaatgaatgcaggcatgagcggt |
31520824 |
T |
 |
| Q |
210 |
agatggaacagagcagaaaggaccacaaatgcatttatcaa |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31520825 |
agatggaacagagcagagaggaccacaaatgcatttatcaa |
31520865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University