View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_94 (Length: 237)
Name: NF1783_low_94
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 107 - 235
Target Start/End: Original strand, 29151728 - 29151856
Alignment:
| Q |
107 |
aaaattcgtaaattcttcgcataaagaaaaataggagtgaaaaagtcattgagtaacaccgccgtttgttgattgggctgggttgttagacatgctatca |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||| | | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151728 |
aaaaatcgtaaattcttcgcataaagaaagaaaagagtgaaaaagtcattgagtaacactgccgtttgttgattgggctgggttgttagacatgctatca |
29151827 |
T |
 |
| Q |
207 |
acactttccggcggttatgaagttatgat |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
29151828 |
acacttttcggcggttatgaagttatgat |
29151856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 21 - 122
Target Start/End: Original strand, 29151480 - 29151581
Alignment:
| Q |
21 |
ggtgtacatcaatgaacagaatcgaaaatgaaaatgaaaattaatattatcttctatagattttgggttcaattctcacctaagataaaattcgtaaatt |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
29151480 |
ggtgtacatcaataaacagaatcgaaaatgaaaatgaaaattaatattatcttctatagattttgggttcaattctcacctaaggtaaaattcataaatt |
29151579 |
T |
 |
| Q |
121 |
ct |
122 |
Q |
| |
|
|| |
|
|
| T |
29151580 |
ct |
29151581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University