View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_95 (Length: 236)
Name: NF1783_low_95
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_95 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 55 - 236
Target Start/End: Complemental strand, 364343 - 364162
Alignment:
| Q |
55 |
aaccatagcttggaacgaaataacaacaaaacatgaaagtagagcgaacgttcaacaactccacaaagttccgtgagacattgttactggaccctgtaaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364343 |
aaccatagcttggaacgaaataacaacaaaacatgaaagtagagcgaacgttcaacaactccacaaagttccgtgagacattgttactggaccctgtaaa |
364244 |
T |
 |
| Q |
155 |
ggaagtcttacacatactacagtaacaggtacttttggttagttttaattcaagttagttgcaatagttacttacggttagc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
364243 |
ggaagtcttacacatactacagtaacaggtacttttggttagttttaattcaagttagttgcaatagttacttacggttagc |
364162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 364413 - 364378
Alignment:
| Q |
16 |
gttaacacggttttgactcaaaaaattggtgaagaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
364413 |
gttaacacggttttgactcaaaaaattggtgaagaa |
364378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University