View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_97 (Length: 236)
Name: NF1783_low_97
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_97 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 27001224 - 27001426
Alignment:
| Q |
16 |
atatggataaagactatccaaagccatgtattagtgtttatagagatattt-catgaagttaatcttttgtctattcattcgtttatatagcatgtgatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27001224 |
atatggataaagactatccaaagccatgtattagtgtttatagagatattttcatgaagttaatcttttgtctattcattcgtttatatagcatgtgatt |
27001323 |
T |
|
| Q |
115 |
aactttaatttaaataatttnnnnnnnnnnnnnnnnctttttagaggcataatttattaagatgaatgatcctaatgatatcatgatgtgaaatatacga |
214 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27001324 |
aacttccatttatataattt----ataaaaaaaaaactttttagaggcataatttattaagatgaatgatcctaatgatatcatgatgtgaaatatacga |
27001419 |
T |
|
| Q |
215 |
ttattct |
221 |
Q |
| |
|
||||||| |
|
|
| T |
27001420 |
ttattct |
27001426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University