View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1783_low_99 (Length: 235)
Name: NF1783_low_99
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1783_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 43793755 - 43793855
Alignment:
| Q |
111 |
ctaatggtgtgtccaaaagcttatgttcatgcaagactttctctactttctctagatccatcatctacttttgtatttcaacaaatattttgattcattg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43793755 |
ctaatggtgtgtccaaaagcttatgttcatgcaagactt---------tctctagatccatcatctacttttgtatttcaacaaatattttgattcattg |
43793845 |
T |
 |
| Q |
211 |
ttgatgttat |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
43793846 |
ttgatgttat |
43793855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43792835 - 43792880
Alignment:
| Q |
1 |
agatccatggaaaatacttgtctaggcacactaaatttaggcacac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43792835 |
agatccatggaaaatacttgtctaggcatactaaatttaggcacac |
43792880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 47335150 - 47335189
Alignment:
| Q |
115 |
tggtgtgtccaaaagcttatgttcatgcaagactttctct |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47335150 |
tggtgtgtccaaaagcttatgttcgtgcaagactttctct |
47335189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University