View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_17 (Length: 491)
Name: NF17841_high_17
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 134 - 479
Target Start/End: Original strand, 116510 - 116859
Alignment:
| Q |
134 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccggattctcagtggtggctagcatatcaaacacctaagtcttattcga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116510 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccaggttctcagtggtggctagcatatcaaacacctaagtcttattcga |
116609 |
T |
 |
| Q |
234 |
ctgatatggatttacattgcccatcctgcttgattaatttcttccatttccgagttattctac----acttgtgagctcagagaatgataccatggccat |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
116610 |
ctgatatggatttacattgctcatcctgcttgattaatttcttccctttccgagttgttctacgtacacttgtgggctcagagaatgataccatggccat |
116709 |
T |
 |
| Q |
330 |
ttttcgtgactgggaaagaatcgatttcgatgcccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaa |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116710 |
ttttcgtgactgggaaagaatcgatttcgatgtccatctcaagcattctcttatttgctagcttaaacataccctcattattttttaatagattttcaaa |
116809 |
T |
 |
| Q |
430 |
tgacaatgcaattaaatgttgagtggttgttggagttgccgatgatgtcc |
479 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
116810 |
tgacaatgcaattaaatgttgagtggttgttggagttgcctatgatgtcc |
116859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 116287 - 116333
Alignment:
| Q |
58 |
aatcaattctaccatttgattcatgtcttcttctgttaggaatccac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
116287 |
aatcaattctaccatttgattcatgtcttcttccgttagaaatccac |
116333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 136
Target Start/End: Original strand, 116423 - 116455
Alignment:
| Q |
104 |
cagctgaggtcattggtgtatcgagttcctaca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
116423 |
cagctgaggtcattggtgtatcgagttcctaca |
116455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University