View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_45 (Length: 254)
Name: NF17841_high_45
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 53038130 - 53037920
Alignment:
| Q |
10 |
attatacttttatgacaatgacatc----aaacaagattacaaggcaacacacatatgcttatgaaatgaatattggtttccttataccaacattgctac |
105 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53038130 |
attatacttttatcacaatgacatcgatcaaacaagattacaaggcaacacacatatgcttatgaaatgaatatt---------------acattgctac |
53038046 |
T |
|
| Q |
106 |
atataattcaattaaattttatacttattttgtttaggttatttgtaaagtctagaattatccaacttaattatttttagtttctgcatgtcaatacatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53038045 |
atataattcaattaaattttatacttattttgtttaggttatttataaagtctagaattacccaac----ttatttttagtttctgcatgtcaatacatc |
53037950 |
T |
|
| Q |
206 |
catgcatggatcacacaatgtcttgataaaaatg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53037949 |
----catggatcacacaatgtcttgataaaaatg |
53037920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 239
Target Start/End: Original strand, 39995636 - 39995672
Alignment:
| Q |
203 |
atccatgcatggatcacacaatgtcttgataaaaatg |
239 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39995636 |
atccatccatggatcacacaatgtcttgataaaaatg |
39995672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University