View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_48 (Length: 249)
Name: NF17841_high_48
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 6 - 158
Target Start/End: Original strand, 42331444 - 42331596
Alignment:
| Q |
6 |
aggttattccattttttccgatagagtcaagaatacgaaatttgaaagatgcaattggtggattatttgtggactcttctgcatataatttgatagcaac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331444 |
aggttattccattttttccgatagagtcaagaatacgaaatttgaaagatgcaattggtggattatttgtggactcttctgcatataatttgatagcaac |
42331543 |
T |
|
| Q |
106 |
cggactagagagggaatccctcgagaatgatatgtgccttcgtgttgggaagt |
158 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42331544 |
cggactagaaagggaatccctcgagaatgatatgtgccttcgtgttgggaagt |
42331596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University