View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_53 (Length: 242)
Name: NF17841_high_53
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 9334189 - 9334007
Alignment:
| Q |
1 |
cttttgttagtgctgttgttattttcttattattactgtcattacttttctttt------gttcttagaatattccaataaagatggtgagcatgaggtt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9334189 |
cttttgttagtgctgttgttattttcttattattactgtcatcacttttctttttcttttgttcttagaatattccaataaagatagtgagcatgaggtt |
9334090 |
T |
|
| Q |
95 |
tggcaagttcgtgcaatcaccattctgttagaacccttgtggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
182 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9334089 |
tggcaagttcatacaatcaccattctgttagaac-----aggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
9334007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 9328871 - 9328708
Alignment:
| Q |
1 |
cttttgttagtgctgttgttattttcttattattactgtcattacttttcttttgttcttagaatattccaataaagatggtgagcatgaggtttggcaa |
100 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
9328871 |
cttttgttattgctgctgttattttcttattattactgtcatcactcttcttttgttcttagaata--------aagatagtgagcatgagatttggcaa |
9328780 |
T |
|
| Q |
101 |
gttcgtgcaatcaccattctgttagaacccttgtggtaggcagtagagagaatagttttctctcaactgaggagcttaggct |
182 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
9328779 |
----------tcaacattctgttagaacacttgtggtaggcagtagagagaatagttttctctcaaaagaggatcttaggct |
9328708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 9333579 - 9333529
Alignment:
| Q |
179 |
ggcttgactcatgtgagagtgcaggttcttacattcactcttcatgatttt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9333579 |
ggcttgactcatgtgagagtgcaggttcttacattcactcttcatgatttt |
9333529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University