View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_59 (Length: 218)
Name: NF17841_high_59
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 36536953 - 36537147
Alignment:
| Q |
1 |
ttgttgacgatgtggcggttcaatgattcttttggtttgttttgtggttggattccaaaggaaaagggttgagtattggtctaaggaataatgagcaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536953 |
ttgttgacgatgtggcggttcaatgattcttttggtttgttttgtggttggattccaaaggaaaagggttgagtattggtctaaggaataatgagcaata |
36537052 |
T |
|
| Q |
101 |
caaaataaaccattgcatgaagctatgatcttataacccatatcagaatttgtaactcttggaatatgaagctctttgagatgttttgttttggt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537053 |
caaaataaaccattgcatgaagctatgatcttataacccatatcagaatttgtaactcttggaatatgaagctctttgagatgttttgttttggt |
36537147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University