View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_high_61 (Length: 205)
Name: NF17841_high_61
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_high_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 6955761 - 6955939
Alignment:
| Q |
17 |
actttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6955761 |
actttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgca |
6955860 |
T |
|
| Q |
117 |
agacattcgtagatgaaggacattgaaaagtgccgtc------tcgaagcttgttcttagaaattagggctaccttcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6955861 |
agacattcgtagatgaaggacattgaaaactgccgtcgataaatcgaagcttgttcttagaaattagggctaccttcat |
6955939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 22454846 - 22454767
Alignment:
| Q |
18 |
ctttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22454846 |
ctttgtcgatccataaaatggatttagaaatactttcaaaaattgagcattgaagccatgagagaaccatgttgttgcag |
22454767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University