View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17841_high_61 (Length: 205)

Name: NF17841_high_61
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17841_high_61
NF17841_high_61
[»] chr6 (1 HSPs)
chr6 (17-189)||(6955761-6955939)
[»] chr8 (1 HSPs)
chr8 (18-97)||(22454767-22454846)


Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 6955761 - 6955939
Alignment:
17 actttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6955761 actttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgca 6955860  T
117 agacattcgtagatgaaggacattgaaaagtgccgtc------tcgaagcttgttcttagaaattagggctaccttcat 189  Q
    ||||||||||||||||||||||||||||| |||||||      ||||||||||||||||||||||||||||||||||||    
6955861 agacattcgtagatgaaggacattgaaaactgccgtcgataaatcgaagcttgttcttagaaattagggctaccttcat 6955939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 22454846 - 22454767
Alignment:
18 ctttgtcgatccataaaatggatttagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcag 97  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
22454846 ctttgtcgatccataaaatggatttagaaatactttcaaaaattgagcattgaagccatgagagaaccatgttgttgcag 22454767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University