View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_39 (Length: 297)
Name: NF17841_low_39
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_39 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 297
Target Start/End: Complemental strand, 41325752 - 41325472
Alignment:
| Q |
18 |
aaactcatagacctcatgctcctgctaaaggtataaaccaagcatcaattattcatttatttagcaaaatgaataccactactgtccatcattttgaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325752 |
aaactcatagacctcatgctcctgctaaaggtataaaccaagcatcaattattcatttatttagcaaaatgaataccactactgtccatcattttgaatc |
41325653 |
T |
 |
| Q |
118 |
ttcagaaattgcaaacttgaactgcaggttcagatgctcaagatcaagaccacttccgaagagagggcagataaaatcaaagatagtagccaatgtttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325652 |
ttcagaaattgcaaacttgaactgcaggttcagatgctcaagatcaagaccacttccgaagagagggcagataaaatcaaagatagtagccaatgtttgt |
41325553 |
T |
 |
| Q |
218 |
catt-cattgtctctgttatttacagagcttcatcacttggcttgcattcttcaacaaaaaactaactaatcatttttgaa |
297 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41325552 |
cattccattgtctctgttatttacagagcttcatcacttggcttgcattcttcaacaaaaaactaactagtcatttttgaa |
41325472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University