View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_47 (Length: 267)
Name: NF17841_low_47
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 6441412 - 6441176
Alignment:
| Q |
14 |
atgaagagttcaaaagtggcgtagtttctaagtctggatagctacgacccttgtctgctgagtttttggtggttaaactctag-aattgtagttgtttct |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6441412 |
atgaagagttcaaaagtagcgtagtttctaagtctggataggtacgacccttgtctgctgagtttttggtggttaaactctaggaattgtagttgtttct |
6441313 |
T |
 |
| Q |
113 |
aagcatttatcaaccaatgaagtcttaatggtggctacttaaggcacaaacataacgaccaattttcaacacattgtatgaattttacttattgtaactt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
6441312 |
aagcatttatcaaccaatgaagtcttaatggtggctacttaaggcacaaacataacgaccaattttctacgcattgtatgaattttacttattgtaactt |
6441213 |
T |
 |
| Q |
213 |
gagaattttcatattctctcattgggagcttgcttctt |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6441212 |
gagaattttcatattctctcatt-ggagcttgcttctt |
6441176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University