View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_48 (Length: 255)
Name: NF17841_low_48
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 37382592 - 37382668
Alignment:
| Q |
148 |
acttgtcaatgtagattaatataaatttttgttactagattagtggctgacacatgcatgaacaaacaggggggaga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37382592 |
acttgtcaatgtagattaatataattttttgttactagattagtggctgacacatgcatgaacaaacaggggggaga |
37382668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 83
Target Start/End: Original strand, 37382456 - 37382527
Alignment:
| Q |
12 |
aattctgaaagtaaagtatatatggtcctctttttagatgatatatggtcccatttattatatgtgaataca |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37382456 |
aattctgaaagtaaagtatatatggtcctttttttagatgatatatggtcccatttattatatgtgaataca |
37382527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University