View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_53 (Length: 247)
Name: NF17841_low_53
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 35167478 - 35167239
Alignment:
| Q |
1 |
aagattgtggatcgatatgaaaagcttgaagagcgcgtgaacggcaaaggttttcgatttggtcgatgaattcgttaccgccgtagtaacggttacccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167478 |
aagattgtggatcgatatgaaaagcttgaagagcgcgtgaacggcaaaggttttcgatttggtcgatgaattcgttaccgccgtagtaacggttacccgg |
35167379 |
T |
|
| Q |
101 |
catgccttcggagtatttgttggttaaagcgctgccgagagcttcgatgacggcgaaggaagtgaaattttcggatgcgatgagttcgattccgcggcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167378 |
catgccttcggagtatttgttggttaaagcgctgccgagagcttcgatgacggcgaaggaggtgaaattttcggatgcgatgagttcgattccgcggcat |
35167279 |
T |
|
| Q |
201 |
tggcgacgtttttctttttcgattaggtcgtggatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35167278 |
tggcgacgtttttctttttcgattaggtcgtggatctctg |
35167239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 30 - 240
Target Start/End: Original strand, 38069242 - 38069452
Alignment:
| Q |
30 |
agagcgcgtgaacggcaaaggttttcgatttggtcgatgaattcgttaccgccgtagtaacggttacccggcatgccttcggagtatttgttggttaaag |
129 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| | | |
|
|
| T |
38069242 |
agagcgcgtgagcggcaaatgttttcgatctggtcgatgaattcgttgccgccgtagtaacggttaccgggcatgccctcggagtatttgttggtgaggg |
38069341 |
T |
|
| Q |
130 |
cgctgccgagagcttcgatgacggcgaaggaagtgaaattttcggatgcgatgagttcgattccgcggcattggcgacgtttttctttttcgattaggtc |
229 |
Q |
| |
|
|||| || || ||||| ||||| |||||||| ||||||||||| || || ||||||||||||||||||||||| || || |||||||||||||||| ||| |
|
|
| T |
38069342 |
cgcttcctagggcttcaatgactgcgaaggaggtgaaattttctgaggctatgagttcgattccgcggcattgacggcgcttttctttttcgattaagtc |
38069441 |
T |
|
| Q |
230 |
gtggatctctg |
240 |
Q |
| |
|
|||||| |||| |
|
|
| T |
38069442 |
gtggatttctg |
38069452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University