View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_54 (Length: 245)
Name: NF17841_low_54
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 39018995 - 39018779
Alignment:
| Q |
15 |
ggtttgagagacataggagcttcactacctcctggatttcggttttatccaagtgatgaggaattggtttgtcactatctttacaaaaagatcacaaatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39018995 |
ggtttgagagacataggagcttcactacctcctggatttcggttttatccaagtgatgaggaattggtttgtcactatctttacaaaaagatcacaaatg |
39018896 |
T |
|
| Q |
115 |
aggaagttcttaagggtactttgattgaaattgaccttcacatatgtgaaccatggcaacttccaggtatatatgttaattatgcataatttttaaaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39018895 |
aggaagttcttaagggtactttgattgaaattgaccttcacatatgtgaaccatggcaacttccaggtatatatgttaattatgcataatttttaaaata |
39018796 |
T |
|
| Q |
215 |
tgttaattgtatatatt |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39018795 |
tgttaattgtatatatt |
39018779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 188
Target Start/End: Original strand, 30480630 - 30480785
Alignment:
| Q |
33 |
gcttcactacctcctggatttcggttttatccaagtgatgaggaattggtttgtcactatctttacaaaaagatcacaaatgaggaagttcttaagggta |
132 |
Q |
| |
|
|||||||| || ||||| ||||| ||||| || |||||||| || ||||| ||| || ||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
30480630 |
gcttcacttccccctggctttcgattttaccccagtgatgaagagttggtccttcattacctttacaaaaaaatcactaatgaggatgttcttaagggta |
30480729 |
T |
|
| Q |
133 |
ctttgattgaaattgaccttcacatatgtgaaccatggcaacttccaggtatatat |
188 |
Q |
| |
|
| ||| ||||||||| | || | || || || ||||||||||| ||||||||| |
|
|
| T |
30480730 |
ccttggaggaaattgacttgcatacttgcgagccttggcaacttcctggtatatat |
30480785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University