View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17841_low_68 (Length: 203)

Name: NF17841_low_68
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17841_low_68
NF17841_low_68
[»] chr3 (1 HSPs)
chr3 (37-131)||(39181166-39181260)
[»] chr7 (1 HSPs)
chr7 (44-164)||(428939-429058)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 37 - 131
Target Start/End: Complemental strand, 39181260 - 39181166
Alignment:
37 gaattatatttaacaggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatag 131  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39181260 gaattatatttaataggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatag 39181166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 44 - 164
Target Start/End: Complemental strand, 429058 - 428939
Alignment:
44 atttaacaggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatagtttgaactaata 143  Q
    |||||| |||||||||||| |||||| |||||||||||| ||| ||||||||  | |||  |||||||||| || ||||||||||||| |  ||||||||    
429058 atttaataggttgctaaaatattatgccataaataaacataatgcataagggtat-gatgttagaatgatagaagttttaccaaatagctaaaactaata 428960  T
144 tcccccaaatacaaagacttg 164  Q
    ||| || ||||||||||||||    
428959 tcctcctaatacaaagacttg 428939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University