View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17841_low_68 (Length: 203)
Name: NF17841_low_68
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17841_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 37 - 131
Target Start/End: Complemental strand, 39181260 - 39181166
Alignment:
| Q |
37 |
gaattatatttaacaggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatag |
131 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39181260 |
gaattatatttaataggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatag |
39181166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 44 - 164
Target Start/End: Complemental strand, 429058 - 428939
Alignment:
| Q |
44 |
atttaacaggttgctaaaaaattatgtcataaataaacacaatacataagggacttgataatagaatgatataaattttaccaaatagtttgaactaata |
143 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||||||| ||| |||||||| | ||| |||||||||| || ||||||||||||| | |||||||| |
|
|
| T |
429058 |
atttaataggttgctaaaatattatgccataaataaacataatgcataagggtat-gatgttagaatgatagaagttttaccaaatagctaaaactaata |
428960 |
T |
 |
| Q |
144 |
tcccccaaatacaaagacttg |
164 |
Q |
| |
|
||| || |||||||||||||| |
|
|
| T |
428959 |
tcctcctaatacaaagacttg |
428939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University