View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17842_low_21 (Length: 306)
Name: NF17842_low_21
Description: NF17842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17842_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 52 - 108
Target Start/End: Original strand, 26836717 - 26836773
Alignment:
| Q |
52 |
accagtcagataggttcattgagctttagggaatttcactgtcaacttattgatgtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
26836717 |
accagtcagataggttcattgagctttagagaatttcactatcaacttattgatgtg |
26836773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University