View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17842_low_24 (Length: 250)
Name: NF17842_low_24
Description: NF17842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17842_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 41307401 - 41307174
Alignment:
| Q |
18 |
gtatcgtgcaagaaaaaagttgaaacagctacggttatgcagaacacaagtagaacaggtgtcgtgatcatagctaccttcaccttcatattgcaatcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41307401 |
gtatcgtgcaagaaaaaagttgaaacagctacggttatgcagaacacaagtagaacaggtgtcgtgatcatagctaccttcaccttcatattgcaataca |
41307302 |
T |
|
| Q |
118 |
acataaatatcattagtcactttctacctatcttattttttaatcatgcgtgtagataactagatatagtaaaaaattaaacatgcacttt-nnnnnnnt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
41307301 |
acataaatatcattagtcactttctacctatcttattttttaatcatgcgtgtagataactagatatagtaaaaaattaaacatgcaatttaaaaaaaat |
41307202 |
T |
|
| Q |
217 |
tagttaaatagaagaataccccatcaac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41307201 |
tagttaaatagaagaataccccatcaac |
41307174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 41297571 - 41297500
Alignment:
| Q |
31 |
aaaaagttgaaacagctacggttatgcagaacacaagtagaacaggtgtcgtgatcatagctaccttcacct |
102 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| |||||||||||| ||||||| || |||||||||| |
|
|
| T |
41297571 |
aaaaagctgaaacagctgcaactatgcagaacacaagcagaacaggtgtcatgatcatcgccaccttcacct |
41297500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University