View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17842_low_28 (Length: 231)
Name: NF17842_low_28
Description: NF17842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17842_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 18776943 - 18777154
Alignment:
| Q |
1 |
tgataaacataacatcagaagcatagacaaaataaagacaacnnnnnnnntggtgtgcaatctatagttgttgttgcttcttcatcatggccatcatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18776943 |
tgataaacataacatcagaagcatagacaaaataaagacaacaaaaaaaatggtgtgcaatctatagttgttgttgcttcttcatcatggccatcatatc |
18777042 |
T |
 |
| Q |
101 |
aatcatcattgccttctgatcttctggctttagcttcttctcgtactttctgctcttctttgaattcagcaaactgtattcttaacccctcaaccaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18777043 |
aatcatcattgccttctgatcttctggcttgagcttcttctcgtactttctgctcttctttgaattcagcaaactgtattcttaacccctcaaccaattt |
18777142 |
T |
 |
| Q |
201 |
tgattgagtagg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
18777143 |
tgattgagtagg |
18777154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 13894262 - 13894298
Alignment:
| Q |
5 |
aaacataacatcagaagcatagacaaaataaagacaa |
41 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13894262 |
aaacataatatcagaagcatagacaaaacaaagacaa |
13894298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University