View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_36 (Length: 304)
Name: NF17844_high_36
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_36 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 6226880 - 6227179
Alignment:
| Q |
20 |
caattgagatgaaaacgatgaagtcacggtgtggagacgtcggcactacgatctcctctgttcgcgatccctcatggtggtttgcacatgacagtaagga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6226880 |
caattgagatgaaaacgatgaagtcacggtgtggagacgtcggcactacgatctcctctgttcgcgatccctcatggtggtttgcacatgacagtaagga |
6226979 |
T |
|
| Q |
120 |
tttcgcttttccgttttttctattagttatctccccatataagttttcactattttgcaatcacaattttcatgtcaatcaa----------------ta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6226980 |
tttcgcttttccgttttttctattagttatct-cccatataagttttcactattttgcaatcacaattttcatgtcaatcaatctaatgatctgtatcta |
6227078 |
T |
|
| Q |
204 |
tctatctacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattataca |
303 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227079 |
tatatctacaggtttcggcaatgagcttgagtttccattaccttgtccaacacgttgttgtcatactgtttatcatccagttattcgtgttgattataca |
6227178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University