View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_42 (Length: 282)
Name: NF17844_high_42
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 186
Target Start/End: Original strand, 48956729 - 48956904
Alignment:
| Q |
7 |
atgggaccatatacaatacatgaatgaatgaacatacatgcggatgctgttgtgtttattgggagtggtaccacagaacacgttaaaactcaaaagtaac |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48956729 |
atgggaccatatacaatacatga----atgaacatacatgcggatgctgttgtgtttattgggagtggtaccacagaacacgttaaaattcaaaagtaac |
48956824 |
T |
|
| Q |
107 |
taaccctctcatttccaaaacaacatggggactatgttgtttattgccgttgataaacatgaggtggttaatttcatcgc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48956825 |
taaccctctcatttccaaaacaacatggggacgatgttgtttattgccgttgataaacatgaggtggttaatttcatcgc |
48956904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 216 - 273
Target Start/End: Original strand, 48956944 - 48957001
Alignment:
| Q |
216 |
gctactcaccgggccacacgttaacagtagtaaactaaccctctcccttcattcattt |
273 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48956944 |
gctactcaccgtgccacacgttaacagtagtaaactaaccctctcctttcattcattt |
48957001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University