View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_45 (Length: 265)
Name: NF17844_high_45
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 6 - 249
Target Start/End: Complemental strand, 6163894 - 6163651
Alignment:
| Q |
6 |
agtgagatgaaatcatcacctaatgtgaaaagggagatatcacttattgtcaagaatggaagaatgtttatgcttgggcacgccnnnnnnnnnaaatttc |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6163894 |
agtgaaatgaaatcatcacctaatgtgaaaagggagatatcacttattgtcaagaatggaagaatgtttatgcttgggcacgcctttttttttaaatttc |
6163795 |
T |
 |
| Q |
106 |
aattcccttgtatgtatcttgtgatatttttcttgggaaggagaaatccatatcaatttgttgccaatgaatgaagtgtcgtcaatttgaattgttgatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6163794 |
aattcccttgtatgtatcttgtgatatttttcttgggaaggagaaatccatatcaatttgttgccaatgaatgaagtgtcgtcaatttgaattgttgatg |
6163695 |
T |
 |
| Q |
206 |
tggttagatacatgtagttttttaagatccaagatcaaccaaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6163694 |
tggttagatacatgtagttttttaagatccaagatcaaccaaat |
6163651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University