View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_49 (Length: 244)
Name: NF17844_high_49
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 24 - 186
Target Start/End: Complemental strand, 39318205 - 39318043
Alignment:
| Q |
24 |
aatgtttataagctgaacattgtttgtcacaaggttcagttcaatggagtgattattaacatatatcagagtttgacatatggttagttacatataagtt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318205 |
aatgtttataagctgaacattgtttgtcacaaggttcagttcaatggagtgattattaagatatatcagagtttgacatatggttagttacatataagtt |
39318106 |
T |
 |
| Q |
124 |
agttttagaggttacttgttttacaagtaaaccaaatagtcgaactttttattctaatacgtt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39318105 |
agttttagaggttacttgttttacaagtaaaccaaatagtcgaactttttattctactacgtt |
39318043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 237
Target Start/End: Complemental strand, 39316665 - 39316610
Alignment:
| Q |
181 |
tacgttgttatacaagtcattgtatgaatactattaaaataatgagattcatctcac |
237 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
39316665 |
tacgttgttatacaaatcattgtatgaatactatt-aaataatgagattcatttcac |
39316610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Complemental strand, 2610789 - 2610736
Alignment:
| Q |
100 |
catatggttagttacatataagttagttttagaggttacttgttttacaagtaa |
153 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2610789 |
catatggttagttggttagaagttagttttagaggttacttgttttccaagtaa |
2610736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University