View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17844_high_58 (Length: 227)
Name: NF17844_high_58
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17844_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 53 - 212
Target Start/End: Original strand, 31659537 - 31659706
Alignment:
| Q |
53 |
gtatatcacttattatggagcaactagatgtatccatcaa----------ttattcatctatggttgatcgttcgagtatcattgagttttattcgttga |
142 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31659537 |
gtatatcacttattatggagcaaatagatgtatccatcaatccaactcaattattcatctatgtttgatcgttcgagtatcattgagttttattcgttga |
31659636 |
T |
 |
| Q |
143 |
tgaaataaggttgatgaaaaaattacattaatcgcacataaataaattagtagaagaaatgtataaaaac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31659637 |
tgaaataaggttgatgaaaaaattacattaatcacacataaataaattagtagaagaaatgtataaaaac |
31659706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University